Raise and house marmosets in compliance with your local Institutional Animal Care and Use Committee (IACUC) and ensure that all protocols and procedures have been approved by the appropriate ethical and regulatory committees.

For adult marmosets, ensure that there is no detectable neutralizing antibodies for AAV9. This can be conducted by The Penn Vector Core at the University of Pennsylvania (http://gtp.med.upenn.edu/intranethome/core-facilities-internal/immunology-core)

Inject marmosets with desired dose of library (e.g. 2 x 10¹² vector genomes of library) intravenously (e.g. via the femoral vein).

At four weeks post-injection, euthanize marmosets and perfuse with 1X phosphate buffered saline.

Flash freeze tissue (e.g. using 2-methylbutane chilled with dry ice). Separate the brain into coronal blocks and flash freeze the blocks. Store tissue at -80 ºC until ready for processing.

Add 100mg (brain, liver, or spinal cord) and 1mL to bead homogenizer tubes. Use prefilled tubes with 1.5 mm Zirconium beads or 2.8 mm stainless steel beads.

Equipment

Value	Label
Prefilled 2.0ml tubes, Zirconium Beads, 1.5mm Triple-Pure - High Impact, 50pk	NAME
Homogenizer tubes (1.5 mm Zirconium beads)	TYPE
Benchmark Scientific	BRAND
D1032-15	SKU

Equipment

Value	Label
Prefilled 2.0ml tubes, Stainless Steel, 2.8mm Acid Washed, 50pk	NAME
Homogenizer tubes (2.8 stainless steel)	TYPE
Benchmark Scientific	BRAND
D1033-28	SKU

Homogenize tissue in using the following settings:

• Speed: 5.0 m/s
• Time: 30 seconds
• Pause: 1 minute
• Cycles: 2

Incubate for 0h 5m 0s.

Equipment

Value	Label
BEADBUG 6, SIX POSITION HOMOGENIZER, 115V	NAME
Tissue homogenizer (6 position)	TYPE
Benchmark Scientific	BRAND
D1036	SKU

Equipment

Value	Label
BEADBLASTER 24 MICROTUBE HOMOGENIZER, 115V	NAME
Tissue Homogenizer (24 position)	TYPE
Benchmark Scientific	BRAND
D2400	SKU

Centrifuge the homogenizer tubes containing the TRIzol solution and homogenized tissue using the following parameters: 12000x g,4°C. Transfer the supernatant to a new tube (microcentrifuge tube or similar).

Equipment

Value	Label
Centrifuge 5425/5425 R - Microcentrifuge	NAME
Refrigerated centrifuge	TYPE
Eppendorf	BRAND
2231000909	SKU

Equipment

Value	Label
DNA LoBind® Tubes	NAME
Microcentrifuge tubes	TYPE
Eppendorf	BRAND
022431021	SKU

Add 600µL to each tube for every 1mL used for lysis, vortex briefly, and incubate for 0h 3m 0s.

Centrifuge 12000x g,4°C to separate the nucleic acid phase from the protein phase. Transfer the top aqueous phase to a new tube (approximately 500µL)

Equipment

Value	Label
Centrifuge 5425/5425 R - Microcentrifuge	NAME
Refrigerated centrifuge	TYPE
Eppendorf	BRAND
2231000909	SKU

Equipment

Value	Label
DNA LoBind® Tubes	NAME
Microcentrifuge tubes	TYPE
Eppendorf	BRAND
022431021	SKU

Add 1 equivalent volume of isopropanol, 1/10 volume of sodium acetate, and co-precipitant (e.g. 500µL, 50µL, 2-3µL) and vortex briefly. Incubate for 0h 10m 0s.

Centrifuge 12000x g,4°C to pellet nucleic acids. Discard supernatant and wash pellet with 1mL. Centrifuge again 7500x g,4°C and discard supernatant.

Air dry pellet and resuspend in 84µL

Remove RNA by digestion with 3µL and digest with 3µL. Supplement reaction with 10µL. Incubate at Room temperature and 37°C.

Purify with

Amplify the region around the diversified genome insertion by PCR with 25 cycles of 98°C for 0h 0m 10s, 60°C for 0h 0m 30s and72°C for 0h 30m 0s using and 50% of the total extracted viral DNA as a template using primers XF (ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC) and 588-R2lib-R (GTATTCCTTGGTTTTGAACCCAACCG).

Dilute PCR product 1:100 and use as template for an additional round of PCR amplification around the variable region with primers containing Read1 and Read2 sequences by 10 cycles of 98°C for 0h 0m 10s, 59°C for 0h 0m 30s, and 72°C for 0h 0m 10s using and primers 588i-lib-PCR1-6bpUID-F (CACTCATCGACCAATACTTGTACTATCTCTCT) and 588i-lib-PCR1-R (GTATTCCTTGGTTTTGAACCCAACCG).

Purify with

Append Illumina flow cell adapters and unique indices by PCR amplification with

by 10 cycles of 98°C for 0h 0m 10s, 59°C for 0h 0m 30s, and 72°C for 0h 0m 10s using

Run PCR products on a freshly-prepared 2% gel.

Verify the expected size of the band and extract from the gel.

If desired, verify the nucleotide diversity at the randomized insertion site by Sanger sequencing.